IgBLAST 1.13.0 now available


IgBLAST is a popular NCBI package for classifying and analyzing  immunoglobulin and T cell receptor variable domain sequences. We’ve released a new version of IgBLAST with three new improvements:

  1. The new release determines the V gene reading frame from the end of FWR3 region instead of end of V gene.  This helps identify the correct reading frames for rearrangements that have insertions or deletions near the V gene end.
  2. The allowed distance between V gene end and J gene start has been increased to 225 bp to allow detection of ultra long D/N regions.
  3. The standalone program and files has been repackaged to make it easier  to install.

The new release is available from the BLAST FTP area, along with a new manual on GitHub.

2 thoughts on “IgBLAST 1.13.0 now available

  1. please test the above fasta file
    —————————–
    >X
    AGTAAGCAGTGGTATCAACGCAGAGTACGGGGGGCAAACAAAAGTGATTCGAATTCCGGGCATGCTGCACCTAGCAGCACGGTAGCCTGTTACCAGATGACTTCTAAAAAGACAGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACATAATCATCACAGAAGCAATTCGTGATTCTGAAGGGTCACCTGTCTTGCTCAGGGTCCCTCCTGCTCAGCAAGTACCAGATAGATCCGCGGTCAGCTGGACACACTTCTGCTAACCTCTCCTGTGATGACCAAGAGAGACACAACAGGAAACTACAGACAGGAAGTTGACCTGACGCCATCTTCCCACCATCCA
    >X1
    AGTAAGCAGTGGTATCAACGCAGAGTACGGGGGGCAAACAAAAGTGATTCGAATTCCGGGCATGCTGCACCTAGCAGCACGGTAGCCTGTTACCAGATGACTTCTAAAAAGAC
    >X2
    AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACATAATCATCACAGAAGCAATTCGTG
    >X21
    AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACA
    >X23
    AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCA
    >X22
    CATAATCATCACAGAAGCAATTCGTG
    ——————————

    I wonder why some sequences among them can not show the blast results

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s