IgBLAST is a popular NCBI package for classifying and analyzing immunoglobulin and T cell receptor variable domain sequences. We’ve released a new version of IgBLAST with three new improvements:
- The new release determines the V gene reading frame from the end of FWR3 region instead of end of V gene. This helps identify the correct reading frames for rearrangements that have insertions or deletions near the V gene end.
- The allowed distance between V gene end and J gene start has been increased to 225 bp to allow detection of ultra long D/N regions.
- The standalone program and files has been repackaged to make it easier to install.
The new release is available from the BLAST FTP area, along with a new manual on GitHub.
please test the above fasta file
—————————–
>X
AGTAAGCAGTGGTATCAACGCAGAGTACGGGGGGCAAACAAAAGTGATTCGAATTCCGGGCATGCTGCACCTAGCAGCACGGTAGCCTGTTACCAGATGACTTCTAAAAAGACAGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACATAATCATCACAGAAGCAATTCGTGATTCTGAAGGGTCACCTGTCTTGCTCAGGGTCCCTCCTGCTCAGCAAGTACCAGATAGATCCGCGGTCAGCTGGACACACTTCTGCTAACCTCTCCTGTGATGACCAAGAGAGACACAACAGGAAACTACAGACAGGAAGTTGACCTGACGCCATCTTCCCACCATCCA
>X1
AGTAAGCAGTGGTATCAACGCAGAGTACGGGGGGCAAACAAAAGTGATTCGAATTCCGGGCATGCTGCACCTAGCAGCACGGTAGCCTGTTACCAGATGACTTCTAAAAAGAC
>X2
AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACATAATCATCACAGAAGCAATTCGTG
>X21
AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCAATACA
>X23
AGGAATAATCGCATTATGAGTATGACACACGCTCCAGGGTTATTGAGATAGATAGTGATAGCTATTAACCACAAGATGCTGTCA
>X22
CATAATCATCACAGAAGCAATTCGTG
——————————
I wonder why some sequences among them can not show the blast results
Please write to us at info@ncbi.nlm.nih.gov so we can help you.