BLAST+ 2.9.0 now available with enhanced support for new database format and improved performance


The BLAST+ 2.9.0 release is now available from our FTP site.  This latest release has enhanced support for the new BLAST database version (BLASTDBv5).

  • The 2.9.0 programs handle the new four character identifiers for chains of 3D structure records from RCSB Protein Data Bank (PDB).  The previous version of the BLAST databases and programs do not support these identifiers. See the MMDB News for additional details about the PDB change and the impact on NCBI Structure resources.
  • Another important improvement in  2.9.0 is the ability to configure the output separator for tabular and CSV output formats. See the BLAST Manual for details

More  improvements and a few bug fixes with this release are detailed in the release notes.

For more information on new database version, BLASTDBv5 (download), see the previous NCBI Insights article and the recording of our webinar. We will continue to update the BLAST databases in their current version (BLASTDBv4) until September 2019.

3 thoughts on “BLAST+ 2.9.0 now available with enhanced support for new database format and improved performance

  1. Hi, I am looking forward to using these features. Not sure if this is the correct place to look for help but I keep getting an error when trying to use makeblast using this command and would really appreciate some advice.
    #using this command works fine
    makeblastdb -in test.fasta -dbtype nucl -title test.blastdb -out test.blastdb -parse_seqids -blastdb_version 4 -taxid_map test.taxonmap.txt
    #this fails
    makeblastdb -in test.fasta -dbtype nucl -title test.blastdb -out test.blastdb -parse_seqids -blastdb_version 5 -taxid_map test.taxonmap.txt
    #the error is
    Building a new DB, current time: 04/17/2019 16:52:19
    New DB name: /xxx/xxx/test.blastdb
    New DB title: test.blastdb
    Sequence type: Nucleotide
    Deleted existing Nucleotide BLAST database named /xxx/xxx/test.blastdb
    Keep MBits: T
    Maximum file size: 1000000000B
    No volumes were created because no sequences were found.
    Error: mdb_env_open: Invalid argument

    #my taxid file and fasta file look like:
    Abalistes_stellaris 92897
    Abbottina_obtusirostris 463498
    Abbottina_rivularis 5332

    >Abalistes_stellaris
    aaccaaccaactcaaacctacttattttccttggacttacgtctacccttgtagggggtt
    gaggaggactaaaccaaacacaactacgaaaaatcctagcctactcctcaatcgcgcact
    taggatggatggtattaatcattcaattctccccatccctaacactcctaacattaatta
    catacctgactataaccaccgcaacattcctagtttttaaattaaacacctccactaaca
    tggagcccctgatatagcatttccccgaataaataatatgagcttttgacttttacctcc
    ctcactcctccttctactcgcttcttcaagcgtagaagccggggccggaactggatgaac
    agtgtatccccctcttgctggtaatttagcccatgcaggggcttccgtagacctaactat
    >Abbottina_obtusirostris
    atctcaaatcatcgacccgcttctattaacctctctcggacttatatccacactggccgg
    aggatggggcggtctaaatcagacccaactacgaaaaattttggcctattcctctatcgc
    acatataggatgaatgattattgttttacaatacgccccccaactcacactcctcgcact
    agggacatacatcttcatgacctccgcagcatttctcacacttaagacgtcctcagccac
    aaagattaacaccctcgcaataacctgatcaaatagccccatcctaacaacaaccgccgc
    ccttgtcctattatcactaggcggattaccaccactaacgggatttataccaaagtggtt
    gattctacaagagctaacaaaacagggcctccccgccaccgccactattatggcccttgc

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Google photo

You are commenting using your Google account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s