The BLAST+ 2.9.0 release is now available from our FTP site. This latest release has enhanced support for the new BLAST database version (BLASTDBv5).
- The 2.9.0 programs handle the new four character identifiers for chains of 3D structure records from RCSB Protein Data Bank (PDB). The previous version of the BLAST databases and programs do not support these identifiers. See the MMDB News for additional details about the PDB change and the impact on NCBI Structure resources.
- Another important improvement in 2.9.0 is the ability to configure the output separator for tabular and CSV output formats. See the BLAST Manual for details.
More improvements and a few bug fixes with this release are detailed in the release notes.
For more information on new database version, BLASTDBv5 (download), see the previous NCBI Insights article and the recording of our webinar. We will continue to update the BLAST databases in their current version (BLASTDBv4) until September 2019.
Hi, I am looking forward to using these features. Not sure if this is the correct place to look for help but I keep getting an error when trying to use makeblast using this command and would really appreciate some advice.
#using this command works fine
makeblastdb -in test.fasta -dbtype nucl -title test.blastdb -out test.blastdb -parse_seqids -blastdb_version 4 -taxid_map test.taxonmap.txt
#this fails
makeblastdb -in test.fasta -dbtype nucl -title test.blastdb -out test.blastdb -parse_seqids -blastdb_version 5 -taxid_map test.taxonmap.txt
#the error is
Building a new DB, current time: 04/17/2019 16:52:19
New DB name: /xxx/xxx/test.blastdb
New DB title: test.blastdb
Sequence type: Nucleotide
Deleted existing Nucleotide BLAST database named /xxx/xxx/test.blastdb
Keep MBits: T
Maximum file size: 1000000000B
No volumes were created because no sequences were found.
Error: mdb_env_open: Invalid argument
#my taxid file and fasta file look like:
Abalistes_stellaris 92897
Abbottina_obtusirostris 463498
Abbottina_rivularis 5332
>Abalistes_stellaris
aaccaaccaactcaaacctacttattttccttggacttacgtctacccttgtagggggtt
gaggaggactaaaccaaacacaactacgaaaaatcctagcctactcctcaatcgcgcact
taggatggatggtattaatcattcaattctccccatccctaacactcctaacattaatta
catacctgactataaccaccgcaacattcctagtttttaaattaaacacctccactaaca
tggagcccctgatatagcatttccccgaataaataatatgagcttttgacttttacctcc
ctcactcctccttctactcgcttcttcaagcgtagaagccggggccggaactggatgaac
agtgtatccccctcttgctggtaatttagcccatgcaggggcttccgtagacctaactat
>Abbottina_obtusirostris
atctcaaatcatcgacccgcttctattaacctctctcggacttatatccacactggccgg
aggatggggcggtctaaatcagacccaactacgaaaaattttggcctattcctctatcgc
acatataggatgaatgattattgttttacaatacgccccccaactcacactcctcgcact
agggacatacatcttcatgacctccgcagcatttctcacacttaagacgtcctcagccac
aaagattaacaccctcgcaataacctgatcaaatagccccatcctaacaacaaccgccgc
ccttgtcctattatcactaggcggattaccaccactaacgggatttataccaaagtggtt
gattctacaagagctaacaaaacagggcctccccgccaccgccactattatggcccttgc
Hi! Unfortunately, we can’t give full customer support here. Send us an email at info@ncbi.nlm.nih.gov so we can help.
Thanks, will do!
I too encounter the same error. I just tried to set up a custom protein db for running blast to extract non-homologous (human) set of proteins of a bacterial proteome (no. of proteins in the initial proteome is about 4k) on my newly installed standalone Blast (NCBI Blast 2.11.0+). Tried to set up new environment variable for my account and created a new variable and gave its path but again it throws the same error. Could you please help me fix it?
Please send an email with details to blast-help@ncbi.nlm.nih.gov. They can help you fix the problem.
How can I put the citation of this database?